ID: 911404545_911404550

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 911404545 911404550
Species Human (GRCh38) Human (GRCh38)
Location 1:97420257-97420279 1:97420277-97420299
Sequence CCGTCTTCCAGATGCAGATACTG CTGCGTCGAAGGGAGGCGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!