ID: 911407729_911407731

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 911407729 911407731
Species Human (GRCh38) Human (GRCh38)
Location 1:97463632-97463654 1:97463659-97463681
Sequence CCTAGTGACTTGTTGAATAGCTT AAAAATGCTGATAATGATAAGGG
Strand - +
Off-target summary {0: 2, 1: 85, 2: 1610, 3: 1948, 4: 1529} {0: 1, 1: 4, 2: 36, 3: 143, 4: 934}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!