ID: 911413418_911413437

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 911413418 911413437
Species Human (GRCh38) Human (GRCh38)
Location 1:97540275-97540297 1:97540320-97540342
Sequence CCTTCTTCGGGTTAGATTAACTG GGGGTGGGGGGTGGGGGGTGGGG
Strand - +
Off-target summary No data {0: 36, 1: 95, 2: 665, 3: 3302, 4: 12242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!