ID: 911423671_911423674

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 911423671 911423674
Species Human (GRCh38) Human (GRCh38)
Location 1:97679094-97679116 1:97679143-97679165
Sequence CCTATTCCAATGAAAGCAGCTTT GAGTCATTTCATTCACTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 247} {0: 1, 1: 0, 2: 0, 3: 13, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!