ID: 911436983_911436988

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 911436983 911436988
Species Human (GRCh38) Human (GRCh38)
Location 1:97872981-97873003 1:97873003-97873025
Sequence CCCTCCTTCATCTTTATTTTCAG GTTTAAATTCTGGTTCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 748} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!