ID: 911503527_911503531

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 911503527 911503531
Species Human (GRCh38) Human (GRCh38)
Location 1:98719202-98719224 1:98719221-98719243
Sequence CCCATGTAGGGTGCTTAGAATAT ATATTGCCTGGCCCATAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 111} {0: 1, 1: 0, 2: 4, 3: 29, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!