|
Left Crispr |
Right Crispr |
| Crispr ID |
911505708 |
911505712 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:98748068-98748090
|
1:98748097-98748119
|
| Sequence |
CCAGGTTCAAGCGATTCTCCTGC |
CTCCTAAGTAACCAAGTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 41236, 1: 112059, 2: 146946, 3: 86404, 4: 46144} |
{0: 1, 1: 2, 2: 13, 3: 32, 4: 207} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|