ID: 911608237_911608249

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 911608237 911608249
Species Human (GRCh38) Human (GRCh38)
Location 1:99932510-99932532 1:99932552-99932574
Sequence CCTCAGGATCCACCGCCTTGGCC CAGGGGTGAGCCACCACTCCCGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 42, 3: 169, 4: 592} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!