ID: 911670060_911670068

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 911670060 911670068
Species Human (GRCh38) Human (GRCh38)
Location 1:100597759-100597781 1:100597809-100597831
Sequence CCATAAAATGTAACTTTAATCAA CTGGATAAGGGGATGGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 87, 4: 791}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!