ID: 911675295_911675297

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 911675295 911675297
Species Human (GRCh38) Human (GRCh38)
Location 1:100651911-100651933 1:100651951-100651973
Sequence CCTCTTTCTTTCTGTGGTGATAG TGAATATTTCTAAGACCCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!