ID: 911765130_911765136

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 911765130 911765136
Species Human (GRCh38) Human (GRCh38)
Location 1:101665048-101665070 1:101665074-101665096
Sequence CCCAAGCCAATAGGGGAATGACA CTGTAGGGGCTACCTGCATCAGG
Strand - +
Off-target summary No data {0: 1, 1: 23, 2: 41, 3: 53, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!