ID: 911797545_911797549

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 911797545 911797549
Species Human (GRCh38) Human (GRCh38)
Location 1:102092858-102092880 1:102092907-102092929
Sequence CCCTTTGAAGAGGAATTCATCAT ATCACCCAACCTTGATGAGCTGG
Strand - +
Off-target summary {0: 5, 1: 10, 2: 11, 3: 22, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!