ID: 911798721_911798723 |
View in Genome Browser |
Spacer: -1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 911798721 | 911798723 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:102107603-102107625 | 1:102107625-102107647 |
| Sequence | CCAAACAAAGAGATGGGAGGAGC | CCCTACAATCCATCCTCCTCAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 4, 3: 31, 4: 243} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||