ID: 911798721_911798726

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 911798721 911798726
Species Human (GRCh38) Human (GRCh38)
Location 1:102107603-102107625 1:102107627-102107649
Sequence CCAAACAAAGAGATGGGAGGAGC CTACAATCCATCCTCCTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!