ID: 911841450_911841455

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 911841450 911841455
Species Human (GRCh38) Human (GRCh38)
Location 1:102687119-102687141 1:102687170-102687192
Sequence CCTGAAGGTGTGCTGGGAGGCAA GGATCTCTGCTAACTCCAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 22, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!