ID: 911856960_911856964

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 911856960 911856964
Species Human (GRCh38) Human (GRCh38)
Location 1:102890459-102890481 1:102890476-102890498
Sequence CCTTGGAGCCAGGGTCACCTTTG CCTTTGAGACCAGGTAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 243} {0: 1, 1: 0, 2: 2, 3: 34, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!