ID: 911861880_911861884

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 911861880 911861884
Species Human (GRCh38) Human (GRCh38)
Location 1:102961909-102961931 1:102961954-102961976
Sequence CCAGGTGCACCCTGGGAAAAGTG CATATGAATTGAATACCAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 208} {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!