ID: 911905631_911905640

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 911905631 911905640
Species Human (GRCh38) Human (GRCh38)
Location 1:103565108-103565130 1:103565154-103565176
Sequence CCCCAGCAGGTGCCTGAAACCAC TCATCTCTCCAGTATCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 41, 3: 201, 4: 667} {0: 1, 1: 0, 2: 2, 3: 21, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!