ID: 911913063_911913065

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 911913063 911913065
Species Human (GRCh38) Human (GRCh38)
Location 1:103660003-103660025 1:103660027-103660049
Sequence CCTTCTGGAGTGCCTCTAAATGA AATGTGCTGAAACCTCTGAAAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 2, 3: 11, 4: 138} {0: 6, 1: 0, 2: 0, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!