ID: 911915390_911915392

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 911915390 911915392
Species Human (GRCh38) Human (GRCh38)
Location 1:103691921-103691943 1:103691945-103691967
Sequence CCTTTCAGAGGTTTCAGCACATT TCATTTAGAGGCACTCCAGAAGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 2, 3: 11, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!