ID: 911925789_911925800

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 911925789 911925800
Species Human (GRCh38) Human (GRCh38)
Location 1:103830776-103830798 1:103830826-103830848
Sequence CCCACCCTGGCTCCCACAAGCAG ACAACTGCCTGCCAAGGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 14, 3: 36, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!