ID: 912067021_912067025

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 912067021 912067025
Species Human (GRCh38) Human (GRCh38)
Location 1:105756945-105756967 1:105756983-105757005
Sequence CCTGCCTTCTTCTGCATATAACT GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 162, 1: 189, 2: 129, 3: 114, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!