ID: 912075818_912075824

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 912075818 912075824
Species Human (GRCh38) Human (GRCh38)
Location 1:105873764-105873786 1:105873778-105873800
Sequence CCTGAGCTGCCCCACCTTCTCTT CCTTCTCTTGACGGTGATTGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 38, 4: 405} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!