ID: 912135525_912135535

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 912135525 912135535
Species Human (GRCh38) Human (GRCh38)
Location 1:106656327-106656349 1:106656368-106656390
Sequence CCCATGAAGGCCTCTGACATGTG TTGTTTTGGGGATTAACATTTGG
Strand - +
Off-target summary No data {0: 16, 1: 365, 2: 1138, 3: 1341, 4: 1501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!