ID: 912137584_912137589

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 912137584 912137589
Species Human (GRCh38) Human (GRCh38)
Location 1:106680634-106680656 1:106680656-106680678
Sequence CCCTGGTGGCTTCTGGGTGGACG GATGGGTTGGTAGTTTAATCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!