ID: 912173828_912173830

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 912173828 912173830
Species Human (GRCh38) Human (GRCh38)
Location 1:107134092-107134114 1:107134115-107134137
Sequence CCACCTGCTTTCTGGTCACAATG TCTTTTGTGTCTTTGTCTGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!