ID: 912185659_912185663

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 912185659 912185663
Species Human (GRCh38) Human (GRCh38)
Location 1:107272846-107272868 1:107272886-107272908
Sequence CCATTAAGTACAAATGCTTAAGC TCGGAAGCACTTAGAAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 148} {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!