ID: 912207593_912207598

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 912207593 912207598
Species Human (GRCh38) Human (GRCh38)
Location 1:107525557-107525579 1:107525593-107525615
Sequence CCATACGCTTATTATTCAGAGAG GGAAGTTGGGGTAAGTTGCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!