ID: 912265480_912265489

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 912265480 912265489
Species Human (GRCh38) Human (GRCh38)
Location 1:108152878-108152900 1:108152926-108152948
Sequence CCCAGAGGAACTAACTCCTGAGT TATGACATATAGAAAGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 29, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!