ID: 912272618_912272623

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 912272618 912272623
Species Human (GRCh38) Human (GRCh38)
Location 1:108226531-108226553 1:108226570-108226592
Sequence CCCATGGGACACAGAGCTAAGAC CAGCTGTTGGAGAGAACAAATGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 8, 3: 21, 4: 175} {0: 3, 1: 0, 2: 1, 3: 25, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!