|
Left Crispr |
Right Crispr |
| Crispr ID |
912294153 |
912294156 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:108455878-108455900
|
1:108455902-108455924
|
| Sequence |
CCCAGGCAGCAGAGGCGGGAGAA |
CACCTGAGCCCAGGAAGTAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 0, 2: 6, 3: 199, 4: 2599} |
{0: 6, 1: 119, 2: 1089, 3: 5485, 4: 19345} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|