ID: 912337591_912337601

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 912337591 912337601
Species Human (GRCh38) Human (GRCh38)
Location 1:108877078-108877100 1:108877096-108877118
Sequence CCCACGTGACCTGCCGGGGGCGG GGCGGGAGCAGGGGGCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60} {0: 1, 1: 1, 2: 7, 3: 91, 4: 851}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!