ID: 912350132_912350138

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 912350132 912350138
Species Human (GRCh38) Human (GRCh38)
Location 1:109004691-109004713 1:109004735-109004757
Sequence CCTCTGTGCATCAACAGGTGTAT AAAAAACAAAAAGGCAGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 259} {0: 1, 1: 7, 2: 107, 3: 949, 4: 6341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!