ID: 912363467_912363475

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 912363467 912363475
Species Human (GRCh38) Human (GRCh38)
Location 1:109113847-109113869 1:109113874-109113896
Sequence CCCGGGCGCGCGCTCTCCCGCGC GCCGCGCGCACCAGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 257} {0: 1, 1: 0, 2: 2, 3: 17, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!