ID: 912366036_912366042

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 912366036 912366042
Species Human (GRCh38) Human (GRCh38)
Location 1:109134656-109134678 1:109134707-109134729
Sequence CCTGCTTGTGTAGATAAAGCCCT ATTACAACTTTGAAGCCCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!