ID: 912372628_912372634

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 912372628 912372634
Species Human (GRCh38) Human (GRCh38)
Location 1:109185712-109185734 1:109185731-109185753
Sequence CCCCAGGGAGCTCACAGTCCTGT CTGTATGAGAGGCTGGAGAGAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 34, 3: 217, 4: 1350} {0: 1, 1: 0, 2: 0, 3: 39, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!