ID: 912379090_912379095

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 912379090 912379095
Species Human (GRCh38) Human (GRCh38)
Location 1:109237212-109237234 1:109237225-109237247
Sequence CCGACTTCCCCTCTGGGACCCTG TGGGACCCTGTCTTCCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 401} {0: 1, 1: 0, 2: 6, 3: 27, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!