ID: 912384761_912384767

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 912384761 912384767
Species Human (GRCh38) Human (GRCh38)
Location 1:109265788-109265810 1:109265807-109265829
Sequence CCCCACAGGCTCCTTGTCCAGAG AGAGTCTGTGACCCTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 230} {0: 1, 1: 0, 2: 1, 3: 21, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!