ID: 912384761_912384773

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 912384761 912384773
Species Human (GRCh38) Human (GRCh38)
Location 1:109265788-109265810 1:109265837-109265859
Sequence CCCCACAGGCTCCTTGTCCAGAG CCATGCAAGCCAGGTGTCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 230} {0: 1, 1: 0, 2: 0, 3: 16, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!