ID: 912401635_912401648

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 912401635 912401648
Species Human (GRCh38) Human (GRCh38)
Location 1:109398037-109398059 1:109398067-109398089
Sequence CCCTCTTCCCCGGCCCACTCCTC CGCGTCGCCTCCGGCTTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 920} {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!