ID: 912406589_912406593

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 912406589 912406593
Species Human (GRCh38) Human (GRCh38)
Location 1:109443786-109443808 1:109443812-109443834
Sequence CCTACGTAAGGAAATCCCTGTAA CTCTGAACACCAAGGCTCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 13, 3: 39, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!