ID: 912416589_912416596

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 912416589 912416596
Species Human (GRCh38) Human (GRCh38)
Location 1:109512451-109512473 1:109512469-109512491
Sequence CCGGCCTCCCTTTCCTCTTTCTG TTCTGCTGTGTCCAAGGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 236, 4: 2208} {0: 1, 1: 0, 2: 3, 3: 4, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!