ID: 912416589_912416598

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 912416589 912416598
Species Human (GRCh38) Human (GRCh38)
Location 1:109512451-109512473 1:109512494-109512516
Sequence CCGGCCTCCCTTTCCTCTTTCTG AGAGACAGATAGAAAGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 236, 4: 2208} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!