ID: 912435131_912435138

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 912435131 912435138
Species Human (GRCh38) Human (GRCh38)
Location 1:109656382-109656404 1:109656402-109656424
Sequence CCAGCATCATGTCCATGACACTG CTGGGGTACTGGGACATCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151} {0: 3, 1: 2, 2: 2, 3: 11, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!