ID: 912445546_912445557 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 912445546 | 912445557 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:109733369-109733391 | 1:109733397-109733419 |
| Sequence | CCCATGATCCTACCTCCTGGTAC | CCCTTGAGTGTGGGTGGGGCCGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 9, 3: 57, 4: 487} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||