ID: 912445546_912445557

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 912445546 912445557
Species Human (GRCh38) Human (GRCh38)
Location 1:109733369-109733391 1:109733397-109733419
Sequence CCCATGATCCTACCTCCTGGTAC CCCTTGAGTGTGGGTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 266} {0: 1, 1: 1, 2: 9, 3: 57, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!