ID: 912450300_912450313

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 912450300 912450313
Species Human (GRCh38) Human (GRCh38)
Location 1:109764131-109764153 1:109764168-109764190
Sequence CCCTCTTCCCTCTGCCTTTTAGG AACAGGTCAGCATCAGGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 544} {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!