ID: 912451662_912451679

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 912451662 912451679
Species Human (GRCh38) Human (GRCh38)
Location 1:109770961-109770983 1:109771012-109771034
Sequence CCAGGAGCTGGCGGCACTGAGGC CCACGGGTATGGAGGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 318} {0: 1, 1: 0, 2: 0, 3: 18, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!