ID: 912451667_912451679

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 912451667 912451679
Species Human (GRCh38) Human (GRCh38)
Location 1:109770989-109771011 1:109771012-109771034
Sequence CCTGGGCCAGGCCTGGCCAGCAG CCACGGGTATGGAGGGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!