ID: 912463323_912463329

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 912463323 912463329
Species Human (GRCh38) Human (GRCh38)
Location 1:109852054-109852076 1:109852089-109852111
Sequence CCCATCTGTGGGTCACCAGCATC TAGATAAAACCACAAAGATGGGG
Strand - +
Off-target summary {0: 2, 1: 37, 2: 649, 3: 2076, 4: 4493} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!