ID: 912471765_912471774

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 912471765 912471774
Species Human (GRCh38) Human (GRCh38)
Location 1:109911353-109911375 1:109911385-109911407
Sequence CCGCTCAGCCAGGGTGCCCTGCC ACCCGCCACCACCAAGGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 404} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!